TaqMan Assay
Polymorphism ID: CGFID_13566
Assay ID: A-052390
Status: Not Validated
Order number not available. Primers and probes must be ordered individually and formulated as below, or contact ABI for more information
| Concentration | 5' dye | Sequence | 3' dye | Allele | |
|---|---|---|---|---|---|
| Probe 1 | 200 nM | FAM | ACGCCTGTAATCC | MGB | T |
| Probe 2 | 200 nM | VIC | CACGCCTGTCATCC | MGB | G |
| Primer F | 900 nM | CTCGTGATCTGCCCACCTT | |||
| Primer R | 900 nM | CCCCCCAAAAAATCTCTGGATATCG |
Thermocycling conditions: TFVMGB60
Method: 5 ng of sample DNA is dried down and used to do a 5 uL Taqman (5' nuclease assay) reaction. Reactions are set up using 2.5 ul of the 2X Universal Master Mix (Applied Biosystems, Foster City, CA) and assay-specific concentrations of primers and probes (above). All reactions are set up in a 384 (96*4) well plate and heat-sealed using an ABgene ALPS 300 heat sealer and clear heat sealing film (ABgene, Rochester, NY). Reaction plates are thermocycled as above, and endpoint reads are conducted on the ABI 7900HT sequence detection system. Cluster Analysis is conducted on the scatter plot of Allele 1 Rn versus Allele 2 Rn. Genotypic segregation is displayed in the allelic plot, containing four distinct clusters, which represent the NTCs (no template controls) and three possible genotypes clusters along the horizontal, vertical and diagonal axes, which represent the Allele 1, Allele 2 and Allele 1/Allele 2 respectively. The data are then exported in text format for further analysis.
For assay ordering information from Applied Biosystems (Foster City, CA), please note the assay number and ABI Order number (above), which can be used to reference this assay at Applied Biosystems.